sigW [2018-03-18 12:18:24]

RNA polymerase ECF-type sigma factor SigW, required for the adaptation to membrane active agents, activated by alkaline shock and by polymyxin B, vancomycin, cephalosporin C, D-cycloserine, and triton X-100

Locus: BSU01730

Isoelectric point: 8.61

Molecular weight: 21.57 kDa

Protein length: 187 aa

Gene length: 561 bp

Function: adaptation to membrane-active compounds

Product: RNA polymerase ECF-type sigma factor SigW

Essential: no

Synonyms: ybbL

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → RNA synthesis and degradation → Transcription → Sigma factors
• Information processing → Regulation of gene expression → Sigma factors and their control → Sigma factors
• Lifestyles → Coping with stress → Cell envelope stress proteins (controlled by SigM, V, W, X, Y)

Gene

Coordinates: 194,849 → 195,412

Phenotypes of a mutant

• sensitive to ß-lactam antibiotics such as cefuroxime and to fosfomycin PubMed
• Inactivation of alsR, sigD and sigW increases competitive fitness of Bacillus subtilis under non-sporulating conditions PubMed

The protein

Protein family

• ECF subfamily (according to Swiss-Prot)

Effectors of protein activity

• RsiW acts as antagonist of SigW (anti-SigW)

Structure

• 5WUQ (complex with the cytoplasmic domain of RsiW) PubMed

Expression and Regulation

Operons

• Genes: sigW-rsiW
  Description: PubMed

  Sigma factors

  • SigW: sigma factor, PubMed, in SigW regulon

  Regulatory mechanism

  • AbrB: repression, PubMed, in AbrB regulon

  Regulation

  • induced under conditions of alkali shock or in the presence of the toxin SdpC (SigW) PubMed

  Additional information

  • the mRNA is very stable (half-life > 15 min) PubMed

Biological materials

Mutant

• 1A905 ( sigW::erm), PubMed, available at BGSC
• BKE01730 (ΔsigW::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATATTTATCTAACCTCTGC, downstream forward: _UP4_AGGGATCTTTAAGTGGGGTG
• BKK01730 (ΔsigW::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATATTTATCTAACCTCTGC, downstream forward: _UP4_AGGGATCTTTAAGTGGGGTG

Labs working on this gene/protein

• John Helmann, Cornell University, USA Homepage
• Thomas Wiegert, University of Bayreuth, Germany Wiegert-Dateien/Thomas Wiegert.html Homepage

References

Reviews

Loading

The SigW regulon

Loading

Other original publications

Loading